View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_83 (Length: 239)
Name: NF5876_low_83
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_83 |
 |  |
|
| [»] scaffold0775 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0775 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2287 - 2066
Alignment:
| Q |
1 |
tatatttgtctgaaattcataattgtgataagatccctttacaaaactagccatgagtttaagccctacgtaaaagacttttccgttgttacatactttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2287 |
tatatttgtctgaaattcataattgtgataagatccctttacaaaactagctatgaatttaagccctacgtaaaagatttttcggttgttacatactttc |
2188 |
T |
 |
| Q |
101 |
taaccaaatgtttaaaaatagtattccattgttggggatgggaaaataatttatgtccacggtatttgcggataaaatctgtcagagacacaagacacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2187 |
taaccaaatgtttaaaaatagtattccattgttggggatggtaaaataatttatgtccacggtatttgcggataaaatctgtcagagacacaagacacta |
2088 |
T |
 |
| Q |
201 |
gtttaatggatactagtgattg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2087 |
gtttaatggatactagtgattg |
2066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University