View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_87 (Length: 231)
Name: NF5876_low_87
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 217
Target Start/End: Original strand, 39748869 - 39749082
Alignment:
| Q |
4 |
ataggaagtaactcatgggtgattgttatgttgtttcaggatggatatggatatggattgagaccgagactgaggctgcttgattcgacgaaggagacag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39748869 |
ataggaagtaactcatgggtgattgttatgttgtttcaggatggagatggatatggattgagaccgagaccgaggctgcttgattcgacgaaggagacag |
39748968 |
T |
|
| Q |
104 |
aatataatttgatgactgctggggagtttggtgatgattccattacatcaattccttttcaggtgcatgattttgtttcttccaacattcgagtcttttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39748969 |
aatataatttgatgactgctggggagtttggtgatgattccattacatcaattccttttcaggtgcatgattttgtttcttccaacattcgagtcttttg |
39749068 |
T |
|
| Q |
204 |
ctgaatgttgtttt |
217 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39749069 |
ctgaatgttgtttt |
39749082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University