View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5876_low_91 (Length: 224)
Name: NF5876_low_91
Description: NF5876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5876_low_91 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 32007457 - 32007268
Alignment:
| Q |
15 |
gaagccgattgaagtttggctggtaatcatccttctttctttcttctaacaatttcgttcattctattctaaattgtaattgtaatcatacttcaatgca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32007457 |
gaagccgattgaagtttggctggtaatcatccttctttctttcttctaacaatttcgttcattctattctaaattgtaat------catacttcaatgct |
32007364 |
T |
|
| Q |
115 |
cttcttcgtttttattcgcatctctgattcccaaatgcatagaagctcaggttcctagttgcattttaaaattaacttatttttattcacaattac |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32007363 |
tttcttcgttttttttcgcatctctgattcccaaatgcatagaagctcaggttcctagttgcattttaaaattaacttatttttattcacaattac |
32007268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University