View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5877-Insertion-18 (Length: 200)
Name: NF5877-Insertion-18
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5877-Insertion-18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 9 - 200
Target Start/End: Original strand, 39824226 - 39824418
Alignment:
| Q |
9 |
agaacctaattcttcataagaaagatcaagttttggtggaattagttgatcactgttgctattagcatgatcagaaacagtgagtttgattaaaggagca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824226 |
agaacctaattcttcataagaaagatcaagttttggtggaattagttgatcactgttgcaattagcatgatcagaaacagtgagtttgattaaaggagca |
39824325 |
T |
|
| Q |
109 |
acttcgtggcgattagcaatagcatcgattaatgtaggaatctgcatgc-atgagttgaactcaaatcaactatatgaatcactgagaaacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824326 |
acttcgtggcgattagcaatagcatcgattaatgtaggaatctgcatgcaatgagttgaactcaaatcaactatatgaatcactgagaaacct |
39824418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 174
Target Start/End: Complemental strand, 5617112 - 5617031
Alignment:
| Q |
94 |
ttgattaaaggagcaacttcgtggcgattagcaatagcatcgattaatgtaggaatctgcatgc-atgagttgaactcaaat |
174 |
Q |
| |
|
||||||||||||| ||| ||||| |||| ||||| || ||||||| ||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
5617112 |
ttgattaaaggaggaacctcgtgatgatttgcaatggcgtcgattagtgtaggaatctgcatgcaatgtgttaaactcaaat |
5617031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 174
Target Start/End: Complemental strand, 21162399 - 21162318
Alignment:
| Q |
94 |
ttgattaaaggagcaacttcgtggcgattagcaatagcatcgattaatgtaggaatctgcatgc-atgagttgaactcaaat |
174 |
Q |
| |
|
||||||||||||| ||| ||||| |||| ||||| || ||||||| ||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
21162399 |
ttgattaaaggaggaacctcgtgatgatttgcaatggcgtcgattagtgtaggaatctgcatgcaatgtgttaaactcaaat |
21162318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University