View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5877-Insertion-19 (Length: 196)
Name: NF5877-Insertion-19
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5877-Insertion-19 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 196
Target Start/End: Original strand, 973980 - 974167
Alignment:
| Q |
9 |
caacttgcattcaaattttggaaaaagaaattgcccatacactgcctaacttaaaccactagaaaactgacacgtggttgtgaatagaaacctattagcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
973980 |
caacttgcattcaaattttggaaaaagaaattgcccatacactgcctaacttaaaccactagaaaactgacacgtggttgtgaatagaaacctattagcc |
974079 |
T |
 |
| Q |
109 |
atttttggcaaaaacacaactctacttttccttattacccactttggtgcatggccatgcaacatattggaccccgacgtaaacctaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
974080 |
atttttggcaaaaacacaactctacttttccttattacccactttggtgcatggccatgcaacatattggaccccgacgtaaacctaa |
974167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University