View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5877-Insertion-24 (Length: 74)
Name: NF5877-Insertion-24
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5877-Insertion-24 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 7e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 7995294 - 7995363
Alignment:
| Q |
5 |
atcaaattcgtcttagaagccgaagaaaatctctgtctaagtgaaatttcatcaaaactattagtactca |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7995294 |
atcaaattcgtcttagaagccgaagaaaatctttgtctaagtgaaatttcatcaaaactattagtactca |
7995363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 8023507 - 8023438
Alignment:
| Q |
5 |
atcaaattcgtcttagaagccgaagaaaatctctgtctaagtgaaatttcatcaaaactattagtactca |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8023507 |
atcaaattcgtcttagaagccgaagaaaatctttgtctaagtgaaatttcatcaaaactattagtactca |
8023438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University