View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5877_high_10 (Length: 350)

Name: NF5877_high_10
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5877_high_10
NF5877_high_10
[»] chr2 (2 HSPs)
chr2 (10-189)||(34995122-34995301)
chr2 (190-335)||(34994904-34995049)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 10 - 189
Target Start/End: Complemental strand, 34995301 - 34995122
Alignment:
10 ctttatcgagataaataaaaaattgtaacacaaccgcaggctatgtaacaagtaatgagtaggatttgtattgaattgggtgaaattgagaggatgacca 109  Q
    |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||    
34995301 ctttattgagataaatagaaaattgtaacacaaccgcaggctatgtaacaagtaatgagtaggacttgtattgaattaggtgaaattgagaggatgacca 34995202  T
110 cataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgtaattgaattgttaaggatga 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
34995201 cataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgtaaatgaattgttaaggatga 34995122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 190 - 335
Target Start/End: Complemental strand, 34995049 - 34994904
Alignment:
190 attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcactgtgatttttctctgtttaaatcctcca 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
34995049 attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcaccgtgatttttctctgtttaaatcctcca 34994950  T
290 ggtcaggggcggattctgctgatgcagaggcaacgatgattcaaat 335  Q
    ||||||||| |||||||||||||||||||||||||| ||| |||||    
34994949 ggtcaggggtggattctgctgatgcagaggcaacgacgatgcaaat 34994904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University