View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5877_low_10 (Length: 350)
Name: NF5877_low_10
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5877_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 10 - 189
Target Start/End: Complemental strand, 34995301 - 34995122
Alignment:
| Q |
10 |
ctttatcgagataaataaaaaattgtaacacaaccgcaggctatgtaacaagtaatgagtaggatttgtattgaattgggtgaaattgagaggatgacca |
109 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
34995301 |
ctttattgagataaatagaaaattgtaacacaaccgcaggctatgtaacaagtaatgagtaggacttgtattgaattaggtgaaattgagaggatgacca |
34995202 |
T |
|
| Q |
110 |
cataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgtaattgaattgttaaggatga |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34995201 |
cataaccagaaattgatttaaaacccgagccttgtttagttagatcccatgcttatatgtaaatgaattgttaaggatga |
34995122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 190 - 335
Target Start/End: Complemental strand, 34995049 - 34994904
Alignment:
| Q |
190 |
attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcactgtgatttttctctgtttaaatcctcca |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34995049 |
attgttacttaaccttcacttttccaaacaatgtaaaacttccaactctcactcgccacaaatatgaggcaccgtgatttttctctgtttaaatcctcca |
34994950 |
T |
|
| Q |
290 |
ggtcaggggcggattctgctgatgcagaggcaacgatgattcaaat |
335 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
34994949 |
ggtcaggggtggattctgctgatgcagaggcaacgacgatgcaaat |
34994904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University