View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5877_low_14 (Length: 265)

Name: NF5877_low_14
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5877_low_14
NF5877_low_14
[»] chr1 (1 HSPs)
chr1 (166-229)||(28680609-28680672)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 166 - 229
Target Start/End: Original strand, 28680609 - 28680672
Alignment:
166 taaggagtcattataggctagttgctacacgaatttgggagctaaaatcttaagtaacctagtg 229  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28680609 taaggagtgattataggctagttgctacacgaatttgggagctaaaatcttaagtaacctagtg 28680672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University