View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5877_low_21 (Length: 241)
Name: NF5877_low_21
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5877_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 28842865 - 28842655
Alignment:
| Q |
13 |
ttatactgagacagttggtcacaattttacactcaatgcaacttttgatgaagttgatcacacaagctatgaggggctgtggttaccaggaggaagggca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28842865 |
ttatactgagacagttggtcacaattttacactcaatgcaacttttgatgaagttgatcacacaagctatgacgggctgtggttaccaggaggaagggca |
28842766 |
T |
|
| Q |
113 |
ccggagtatcttgctcacattcctagtgttgtggagctggtgactaagtttgttaaatctggaaaagaaattgcttgcatttgtcatggccatttgattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28842765 |
ccggagtatcttgctcacattcctagtgttgtggagctggtgactaagtttgttaaatctggaaaagaaattgcttgcatttgtcatggccatttgattc |
28842666 |
T |
|
| Q |
213 |
tggctgctgct |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
28842665 |
tggctgctgct |
28842655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 28828692 - 28828574
Alignment:
| Q |
13 |
ttatactgagacagttggtcacaattttacactcaatgcaacttttgatgaagttgatcacacaagctatgaggggctgtggttaccaggaggaagggca |
112 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| ||||||||||||| ||||||| ||||| || | ||| ||||||||||| |||||| | |
|
|
| T |
28828692 |
ttatattgagacagttggtcacaaatttacactcaatcgaacttttgatgaaattgatcatacaagttacaatgggttgtggttaccataaggaagcacg |
28828593 |
T |
|
| Q |
113 |
ccggagtatcttgctcaca |
131 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28828592 |
acggagtatcttgctcaca |
28828574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 97
Target Start/End: Complemental strand, 28831618 - 28831563
Alignment:
| Q |
42 |
cactcaatgcaacttttgatgaagttgatcacacaagctatgaggggctgtggtta |
97 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| |||||||||| ||| |||||||| |
|
|
| T |
28831618 |
cactcgatgcaacttttgatgaaattgatcaaccaagctatgatgggttgtggtta |
28831563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 28837947 - 28837906
Alignment:
| Q |
182 |
attgcttgcatttgtcatggccatttgattctggctgctgct |
223 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
28837947 |
attgcttgcttctgtcatggccatttgattctggcagctgct |
28837906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 107
Target Start/End: Original strand, 13382434 - 13382527
Alignment:
| Q |
13 |
ttatactgagacagttggtcacaattttacactcaatgcaacttttgatgaagttgatcacacaagctatgaggggctgtggttaccaggaggaa |
107 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||| ||||||||||| |||| ||||||| ||||||||||| || |||||||| | |||||||| |
|
|
| T |
13382434 |
ttatactgaga-agttggtcacaatttgacactcgatgcaacttttaatgagtttgatcatacaagctatgatggcctgtggttgctaggaggaa |
13382527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University