View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5878-Insertion-7 (Length: 270)
Name: NF5878-Insertion-7
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5878-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 10 - 186
Target Start/End: Complemental strand, 6034393 - 6034217
Alignment:
| Q |
10 |
tacaattgtattcaaagagatgtaatctcaataatattaaggacttcactatacatcaatatcgtattgtagggttttcttgttattattttgtaacttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6034393 |
tacaattgtattcaaagagatgtaatgtcaataatattaaggacttcactatacatcaatatcgtattgtagggttttcttgttattattttgtaacttg |
6034294 |
T |
|
| Q |
110 |
gttctattgcttttcgaggaactccatgttcaacttgtgcatagttagcagttattaatataatctattagcttctt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6034293 |
gttctattgcttttcgaggaactccatgttcaacttgtgcatagttagcagttattaatataatctattagcttctt |
6034217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University