View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5878_high_6 (Length: 293)
Name: NF5878_high_6
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5878_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 40310988 - 40311280
Alignment:
| Q |
1 |
gattctcatgaaccagttggtaattgttactgttattaattgtattgaagtccaatctgtttggcaggtgctgctctgagtcagttataacaggaagtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310988 |
gattctcatgaaccagttggtaattgttactattattaattgtattgaagtccaatctgtttggcaggtgctgctctgagtcagttataacaggaagtct |
40311087 |
T |
 |
| Q |
101 |
ccttaaagcaacccgatcacgtaagaactccgcagaaaattcttcaccggtctgtagacatatattatcttcatcgtctttatcagaagaggttatgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311088 |
ccttaaagcaacccgatcacgtaagaactccgcagaaaattcttcaccggtctgtagacatatattatcttcatcgtctttatcagaagaggttatgtca |
40311187 |
T |
 |
| Q |
201 |
ctaaacacaacacttgttgtacctttatattgatagcctgaaattccagggtcctcattactcatgattgaaaaatatacagttagcttaacc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311188 |
ctaaacacaacacttgttgtacctttatattgatagcctgaaattccagggtcctcattactcatgattgaaaaatatacagttagcttaacc |
40311280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University