View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5879-Insertion-5 (Length: 490)

Name: NF5879-Insertion-5
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5879-Insertion-5
NF5879-Insertion-5
[»] chr7 (1 HSPs)
chr7 (9-490)||(1328187-1328668)
[»] scaffold0009 (1 HSPs)
scaffold0009 (105-143)||(262058-262096)
[»] chr1 (1 HSPs)
chr1 (105-143)||(2829156-2829194)
[»] chr4 (1 HSPs)
chr4 (105-142)||(54591193-54591230)


Alignment Details
Target: chr7 (Bit Score: 474; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 474; E-Value: 0
Query Start/End: Original strand, 9 - 490
Target Start/End: Complemental strand, 1328668 - 1328187
Alignment:
9 aatcctcggtaaccctaacgccgacgaaaccgattcactttcatctcccttccccgaaaacgccgacagaaacaccttccctgaactacttccagcgtgg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1328668 aatcctcggtaaccctaacgccgacgaaaccgattcactttcatctcccttccccgaaaacgccgacagaaacaccttccctgaactacttccagcgtgg 1328569  T
109 atttgtggaagcaacgaattcaaaccaaacacaccacgaatttcgccgtttgatgcaggatcgtgtttgaggaatctggaggatgatgatgcggtggata 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1328568 atttgtggaagcaacgaattcaaaccaaacacaccacgaatttcgccgtttgatgcaggatcgtgtttgaggaatctggaggatgatgatgcggtggata 1328469  T
209 cagcggcggcagtggcggtggttgtggtgcgttgtggaggtggattgataccgttgagccaacgaacgagagcgatacgagatgaacggttaggatcgta 308  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1328468 ctgcggcggcagtggcggtggttgtggtgcgttgtggaggtggattgataccgttgagccaacgaacgagagcgatacgagatgaacggttaggatcgta 1328369  T
309 ttcgatgcgttcgacgataccgacggaagaagaagtgttgcgcttgagatcgatgactcgatgtaaacgtttatggccgccaccgcggtggaaggaggtg 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
1328368 ttcgatgcgttcgacgataccgacggaagaagaagtgttgcgcttgagatcgatgactcgatgtaaacgtttatggccgccgccgcggtggaaggaggtg 1328269  T
409 atgcggccgtaacagttacggccggcggtttttccggcgccgaatgtgaattgtctcagtgatctcttcactcctcctgaca 490  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1328268 atgcggccgtaacagttacggccggcggtttttccggcgccgaatgtgaattgtctcagtgatctcttcactcctcctgaca 1328187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 105 - 143
Target Start/End: Original strand, 262058 - 262096
Alignment:
105 gtggatttgtggaagcaacgaattcaaaccaaacacacc 143  Q
    ||||||||||||||||||| |||||||||||| ||||||    
262058 gtggatttgtggaagcaacaaattcaaaccaagcacacc 262096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 105 - 143
Target Start/End: Original strand, 2829156 - 2829194
Alignment:
105 gtggatttgtggaagcaacgaattcaaaccaaacacacc 143  Q
    ||||||||||||||||||| |||||||||||| ||||||    
2829156 gtggatttgtggaagcaacaaattcaaaccaagcacacc 2829194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 105 - 142
Target Start/End: Original strand, 54591193 - 54591230
Alignment:
105 gtggatttgtggaagcaacgaattcaaaccaaacacac 142  Q
    ||||||||||||||||||| |||||||||||| |||||    
54591193 gtggatttgtggaagcaacaaattcaaaccaagcacac 54591230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University