View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879-Insertion-6 (Length: 300)
Name: NF5879-Insertion-6
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 300
Target Start/End: Complemental strand, 4644536 - 4644267
Alignment:
| Q |
26 |
ttagttctctttctttgtatacataacctgcaaactcgtgagttttaattgaggagatgtggcatatgtctctacaccatttaactcattgattgtgtgt |
125 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4644536 |
ttagttctctttctttgtttacataacctgcaaactcgtgagttttaattgaagagatgtgggatatgtctctacatcatttaactcattgattgtgtgt |
4644437 |
T |
 |
| Q |
126 |
tgctgcttctccaacgagaatgatactatccatactccatagtattcacgccgcgatttgccttatgt--cagcttgaccatttttccgtcgagctgcca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
4644436 |
tgctgcttctccaacgagaatgatacta-------tccacagtattcacgccgcgatttgccttatgtcacagcttgaccattttgccgtcgagccgcca |
4644344 |
T |
 |
| Q |
224 |
ccactaggatgcgaatctctcccgaatgtgcaacaatattctgacttgac-ttttttccatttatttcttttatctta |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
4644343 |
ccactaggatgcgaatctctcctgaatgtgcaacaatattctgacttgactttttttccatttattt-ttttatctta |
4644267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University