View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879-Insertion-7 (Length: 118)
Name: NF5879-Insertion-7
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 9 - 118
Target Start/End: Complemental strand, 40311375 - 40311265
Alignment:
| Q |
9 |
tgtatttctatagggtttaaattctcaagctcgaatgattaaatgcgggatgggcattgagaattttttaagagtttattgcaaaaggt-ggttgggtta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40311375 |
tgtatttctatagggtttaaattctcaagctcgaatgattaaatgcgggatgggcattgagaattttttaagagtttattgcaaaaggtgggttgggtta |
40311276 |
T |
|
| Q |
108 |
agctaactgta |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
40311275 |
agctaactgta |
40311265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University