View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879_high_11 (Length: 244)
Name: NF5879_high_11
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879_high_11 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 1328443 - 1328668
Alignment:
| Q |
1 |
cacacccaccgccactgccgccgctgtatccaccgcatcatcatcctccagattcctcaaacacgatcctgcatcaaacggcgaaattcgtggtgtgttt |
100 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328443 |
cacaaccaccgccactgccgccgcagtatccaccgcatcatcatcctccagattcctcaaacacgatcctgcatcaaacggcgaaattcgtggtgtgttt |
1328542 |
T |
|
| Q |
101 |
ggtttgaattcgttgcttccacaaatccacgctggaagtagttcagggaaggtgtttctgtcggcgttttcggggaagggagatgaaagtgaatcggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328543 |
ggtttgaattcgttgcttccacaaatccacgctggaagtagttcagggaaggtgtttctgtcggcgttttcggggaagggagatgaaagtgaatcggttt |
1328642 |
T |
|
| Q |
201 |
cgtcggcgttagggttaccgaggatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1328643 |
cgtcggcgttagggttaccgaggatt |
1328668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 262096 - 262058
Alignment:
| Q |
92 |
ggtgtgtttggtttgaattcgttgcttccacaaatccac |
130 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
262096 |
ggtgtgcttggtttgaatttgttgcttccacaaatccac |
262058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 130
Target Start/End: Complemental strand, 2829194 - 2829156
Alignment:
| Q |
92 |
ggtgtgtttggtttgaattcgttgcttccacaaatccac |
130 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
2829194 |
ggtgtgcttggtttgaatttgttgcttccacaaatccac |
2829156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 93 - 130
Target Start/End: Complemental strand, 54591230 - 54591193
Alignment:
| Q |
93 |
gtgtgtttggtttgaattcgttgcttccacaaatccac |
130 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
54591230 |
gtgtgcttggtttgaatttgttgcttccacaaatccac |
54591193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University