View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879_high_12 (Length: 232)
Name: NF5879_high_12
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 217
Target Start/End: Complemental strand, 4674622 - 4674417
Alignment:
| Q |
12 |
caagaatatctatgtatttaaagagtccagggaatattttaagttggcataatttggaggcttatttgcatggagtggcaggaacacaagggagtaaaag |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674622 |
caagaaaatctatgtatttaaagagtccagggaatattttaagttggcataatttggaggcttatttgcatggagtggcaggaacacaagggagtaaaag |
4674523 |
T |
|
| Q |
112 |
agtgttcaaacttgaggttaatcgtgatattgcacttgtgaataaaacattggatggtttaaaagatgaataccttgtgccagtgtcatggagggttgta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674522 |
agtgttcaaacttgaggttaatcgtgatattgcacttgtgaataaaacattggatggtttaaaagatgaataccttgtgccagtgtcatggagggttgta |
4674423 |
T |
|
| Q |
212 |
gagaat |
217 |
Q |
| |
|
|||||| |
|
|
| T |
4674422 |
gagaat |
4674417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 66 - 147
Target Start/End: Complemental strand, 34547963 - 34547882
Alignment:
| Q |
66 |
tggaggcttatttgcatggagtggcaggaacacaagggagtaaaagagtgttcaaacttgaggttaatcgtgatattgcact |
147 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||| |||||| ||| |||||| | ||||| |||||||| |||||||| |
|
|
| T |
34547963 |
tggaggtttacttgcatggaattgcaggaacacaaggaagtaaaggagggttcaatttagaggtgaatcgtgacattgcact |
34547882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 147
Target Start/End: Complemental strand, 34556456 - 34556375
Alignment:
| Q |
66 |
tggaggcttatttgcatggagtggcaggaacacaagggagtaaaagagtgttcaaacttgaggttaatcgtgatattgcact |
147 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||| || ||| ||| |||||| | ||||| |||||||| |||||||| |
|
|
| T |
34556456 |
tggaggtttacttgcatggaattgcaggaacacaaggaagcaaaggagggttcaatttggaggtgaatcgtgacattgcact |
34556375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University