View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879_low_12 (Length: 256)
Name: NF5879_low_12
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 51935632 - 51935413
Alignment:
| Q |
19 |
cacagaatcaaagtccgaatagtatctgcaagagcttatcattctctatttatgcataatatgtgagtactaatggaatcacctatctttttcacacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51935632 |
cacagaatcaaagtccgaatagtatctgcaagagcttatcattctctatttatgcataatatgtgagtactaatggaatcacctatctttttcacacaaa |
51935533 |
T |
 |
| Q |
119 |
tattttaagccgtaccaattaattctttgcaaccttaaaaactagatttagcatgcacaattatacgacaannnnnnnacaggtgcatccgaccaacacc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51935532 |
tattttaagccgtaccaattaattctttgcaaccttaaaaactagatttagcatgcacaattatacgacaatttttttacaggtgcatccgaccaacacc |
51935433 |
T |
 |
| Q |
219 |
tgaagagctagaggaatttg |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51935432 |
tgaagagctagaggaatttg |
51935413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 28138358 - 28138296
Alignment:
| Q |
20 |
acagaatcaaagtccgaatagtatctgcaagagcttatcattctctatttatgcataatatgt |
82 |
Q |
| |
|
|||||||||||||| | || || ||||| |||||||||||||| || ||||||||||| |||| |
|
|
| T |
28138358 |
acagaatcaaagtcaggattgtctctgccagagcttatcattcactctttatgcataacatgt |
28138296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University