View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879_low_7 (Length: 324)
Name: NF5879_low_7
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 45 - 291
Target Start/End: Original strand, 4644295 - 4644536
Alignment:
| Q |
45 |
tcaagtcagaatattgttgcacattcgggagagattcgcatcctagtggtggcagctcgacggaaaaatggtcaagctg--acataaggcaaatcgcggc |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4644295 |
tcaagtcagaatattgttgcacattcaggagagattcgcatcctagtggtggcggctcgacggcaaaatggtcaagctgtgacataaggcaaatcgcggc |
4644394 |
T |
 |
| Q |
143 |
gtgaatactatggagtatggatagtatcattctcgttggagaagcagcaacacacaatcaatgagttaaatgatgtagagacatatgccacatctcttca |
242 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4644395 |
gtgaatactgtgga-------tagtatcattctcgttggagaagcagcaacacacaatcaatgagttaaatgatgtagagacatatcccacatctcttca |
4644487 |
T |
 |
| Q |
243 |
attaaaactcacgagtttgcaggttatgtatacaaagaaagagaactaa |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4644488 |
attaaaactcacgagtttgcaggttatgtaaacaaagaaagagaactaa |
4644536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University