View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5879_low_8 (Length: 298)
Name: NF5879_low_8
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5879_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 25 - 278
Target Start/End: Complemental strand, 1328439 - 1328186
Alignment:
| Q |
25 |
cgttgtggaggtggattgataccgttgagccaacgaacgagagcgatacgagatgaacggttaggatcgtattcgatgcgttcgacgataccgacggaag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328439 |
cgttgtggaggtggattgataccgttgagccaacgaacgagagcgatacgagatgaacggttaggatcgtattcgatgcgttcgacgataccgacggaag |
1328340 |
T |
|
| Q |
125 |
aagaagtgttgcgcttgagatcgatgactcgatgtaaacgtttatggccgccaccgcggtggaaggaggtgatgcggccgtaacagttacggccggcggt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328339 |
aagaagtgttgcgcttgagatcgatgactcgatgtaaacgtttatggccgccgccgcggtggaaggaggtgatgcggccgtaacagttacggccggcggt |
1328240 |
T |
|
| Q |
225 |
ttttccggcgccgaatgtgaattgtctcagtgatctcttcactcctcctgacat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328239 |
ttttccggcgccgaatgtgaattgtctcagtgatctcttcactcctcctgacat |
1328186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University