View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880-Insertion-8 (Length: 169)
Name: NF5880-Insertion-8
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880-Insertion-8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 27511116 - 27511071
Alignment:
| Q |
21 |
ttaattaacttaagaacctttcacatggagtatgacatgtgctctg |
66 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
27511116 |
ttaattaatttgagaacgtttcacatggagtatgacatgtgctctg |
27511071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 72
Target Start/End: Original strand, 31948779 - 31948834
Alignment:
| Q |
17 |
ggatttaattaacttaagaacctttcacatggagtatgacatgtgctctgtaagtt |
72 |
Q |
| |
|
|||||| |||||||| |||| ||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
31948779 |
ggatttgattaacttgagaatcttccacatggagtatgacatgtgctatgtgagtt |
31948834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University