View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_high_11 (Length: 338)
Name: NF5880_high_11
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 26583317 - 26583212
Alignment:
| Q |
10 |
attattctccctgcataaagatggcttctcgccacaatgaagacaacacacgcaaaattctatatagtctcactagagaattacctcaacgattcgccgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26583317 |
attattctccctgcataaagatggcttctcgccacaatgaagacaacacacgcaaaattctatatagtctcactagagaattacctcaacgattcgccgc |
26583218 |
T |
 |
| Q |
110 |
atctcg |
115 |
Q |
| |
|
|||||| |
|
|
| T |
26583217 |
atctcg |
26583212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 278 - 319
Target Start/End: Complemental strand, 26583183 - 26583142
Alignment:
| Q |
278 |
ggatttactaaagttagtgttctaagaaaatttcttaatgta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26583183 |
ggatttactaaagttagtgttctaagaaaatttcttaatgta |
26583142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University