View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5880_high_11 (Length: 338)

Name: NF5880_high_11
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5880_high_11
NF5880_high_11
[»] chr1 (2 HSPs)
chr1 (10-115)||(26583212-26583317)
chr1 (278-319)||(26583142-26583183)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 26583317 - 26583212
Alignment:
10 attattctccctgcataaagatggcttctcgccacaatgaagacaacacacgcaaaattctatatagtctcactagagaattacctcaacgattcgccgc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26583317 attattctccctgcataaagatggcttctcgccacaatgaagacaacacacgcaaaattctatatagtctcactagagaattacctcaacgattcgccgc 26583218  T
110 atctcg 115  Q
    ||||||    
26583217 atctcg 26583212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 278 - 319
Target Start/End: Complemental strand, 26583183 - 26583142
Alignment:
278 ggatttactaaagttagtgttctaagaaaatttcttaatgta 319  Q
    ||||||||||||||||||||||||||||||||||||||||||    
26583183 ggatttactaaagttagtgttctaagaaaatttcttaatgta 26583142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University