View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_high_16 (Length: 309)
Name: NF5880_high_16
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_high_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 15 - 309
Target Start/End: Original strand, 1436401 - 1436695
Alignment:
| Q |
15 |
aatattaatgggtatatcctaattcactctatgtatacctcttatcccttctcaaaccaaatatacaagcttcttgtgtcaattatagacagccaataac |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1436401 |
aatatgaatgggtatatcctaattcactctatgtatacctcttatcccttctcaaaccaaatatacaagcttcttgtgtcaattatagacagccaataac |
1436500 |
T |
 |
| Q |
115 |
caatttattatttcaatgaattagttggttataatgcaaggaaaaataattccatgtagagtcttctttcgttcctaacaaattcaatgaaatcagtcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1436501 |
caatttattatttcaatgaattagttggttataatgcaaggaaaaataattccatgtagagtcttctttcgttcctaacaaattcaatgaaatcagtcaa |
1436600 |
T |
 |
| Q |
215 |
agaaaccaaatcaagacacaaatcaaatcacaagtattgttgaggaaacaataacaactttgtaaccttcactagaagacaaattaacttgaaat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1436601 |
agaaaccaaatcaagacacaaatcaaatcacaagtattgttgaggaaacaataacaactttgtaaccttcactagaagacaaattaacatgaaat |
1436695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University