View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_high_26 (Length: 248)
Name: NF5880_high_26
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_high_26 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 21196 - 21441
Alignment:
| Q |
1 |
tcatgtcgagcagcttgtattgccataatgttaaaaatgaagtgcactttgtaaaacatgcttacaaagtcttgatgcggcacgttgaagaa-gaaaaat |
99 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21196 |
tcatgtcgaacaacttgtattgccataatgttaaaaatgaagtgcactttgtaaaacatgcttacaaagtcttgatgcggcacgttgaagaaagaaaaat |
21295 |
T |
 |
| Q |
100 |
gactattact-------------tggaacaagaaggtcccattgaatgttctttatttgcttagcgactgtaatatgatcagttgcatacaaaagataat |
186 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21296 |
gactattactccataatatgatttggaacaagaaggtcccattgaatgttctttattttcttagcgactgtaatatgatcagttgcatacaaaagataat |
21395 |
T |
 |
| Q |
187 |
tagttaaaaacaagtgttttagttttgaatggtaatttgtgttttg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21396 |
tagttaaaaacaagtgttttagttttgaatggtaatctgtgttttg |
21441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University