View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_low_15 (Length: 309)
Name: NF5880_low_15
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 44915323 - 44915134
Alignment:
| Q |
16 |
catgttgtgccattctttgttgaagccgtacttgttgtgggtctaaattgccctttatccctgcaccgtctattctttccgtatcaaattgttgtgcctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
44915323 |
catgttgtgccattctttgttgaagccgtacttgttgtgggtctaaattgcactttatccctgcaccatctattctttctgtatcaaattgttgtgcctt |
44915224 |
T |
 |
| Q |
116 |
ggcgactaacctcataccttgctgactagaagcaaattgagtgccccctgactgttgatttaaccccccttcaaaaacctgctggggaaa |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44915223 |
ggcgactaacctcatgccttgctgactagaagcaaattgagtgccccctgactgttgatttaaccccccttcaaaaacctgctgtggaaa |
44915134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 69 - 214
Target Start/End: Complemental strand, 7748986 - 7748841
Alignment:
| Q |
69 |
tttatccctgcaccgtctattctttccgtatcaaattgttgtgccttggcgactaacctcataccttgctgactagaagcaaattgagtgccccctgact |
168 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||||| | ||||||| ||||||||||| |||||||||| ||||||||||||| | |||||| | |
|
|
| T |
7748986 |
tttatccctgcaccatctattctttccatttcaaattgttcttccttggcaactaacctcatgccttgctgaccagaagcaaattgaatagcccctgtat |
7748887 |
T |
 |
| Q |
169 |
gttgatttaaccccccttcaaaaacctgctggggaaatttctgaac |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
7748886 |
cttgatttaaccccccttcaaaaccctgctggggaaacttctgaac |
7748841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 212 - 297
Target Start/End: Complemental strand, 7749446 - 7749361
Alignment:
| Q |
212 |
aactacactcatcgctggggtcttgggaacggacttagatctccgttttgcagctaggcgttcctgttgttgcctttgtgtagaat |
297 |
Q |
| |
|
|||| ||||||| || || |||||||||| ||| |||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7749446 |
aactccactcattgcaggtgtcttgggaagggaattagatctccgttttgcagctaggtgtgcctgttgttgcctttgtgtagaat |
7749361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 7749069 - 7749019
Alignment:
| Q |
16 |
catgttgtgccattctttgttgaagccgtacttgttgtgggtctaaattgc |
66 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
7749069 |
catgttgtggcattctttgctgaagccgtaattgttgtgggtctaaattgc |
7749019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 212 - 290
Target Start/End: Complemental strand, 44915663 - 44915584
Alignment:
| Q |
212 |
aactacactcatcgctggggtcttgggaacggacttagatc-tccgttttgcagctaggcgttcctgttgttgcctttgt |
290 |
Q |
| |
|
|||| ||||||| | |||||||||||||| ||| |||||| ||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
44915663 |
aactccactcattgttggggtcttgggaagggaattagattatccattttgcagctaggtgtgtctgttgttgcctttgt |
44915584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 69 - 213
Target Start/End: Complemental strand, 2338904 - 2338760
Alignment:
| Q |
69 |
tttatccctgcaccgtctattctttccgtatcaaattgttgtgccttggcgactaacctcataccttgctgactagaagcaaattgagtgccccctgact |
168 |
Q |
| |
|
||||||| |||||| ||| |||||||| | |||||||| | | |||| | ||||||||||| |||||||||| ||||| ||||||| | |||||| || |
|
|
| T |
2338904 |
tttatccttgcaccatcttttctttccatttcaaattggtctaccttatcaactaacctcatgccttgctgaccagaagaaaattgaatagcccctgtct |
2338805 |
T |
 |
| Q |
169 |
gttgatttaaccccccttcaaaaacctgctggggaaatttctgaa |
213 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
2338804 |
cttgatttaaacccccatcaaaaacctgctggggaaacttctgaa |
2338760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 212 - 297
Target Start/End: Complemental strand, 2339331 - 2339246
Alignment:
| Q |
212 |
aactacactcatcgctggggtcttgggaacggacttagatctccgttttgcagctaggcgttcctgttgttgcctttgtgtagaat |
297 |
Q |
| |
|
|||| ||||||| | |||||||||||||| ||| ||||||| |||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
2339331 |
aactccactcattgatggggtcttgggaaaggaattagatccccgttttgcagctaggtgtgcctgttgttgcctttgagtagaat |
2339246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University