View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_low_18 (Length: 305)
Name: NF5880_low_18
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 25209530 - 25209808
Alignment:
| Q |
19 |
caacagctatgaaataatnnnnnnnttaatctgccataaaaatatttagaagatgctcttgtagaactttcatcacaagaatccagagtccatgtttttt |
118 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25209530 |
caacagctatgaaataataaaaaaattaatctaccataaaaatatttagaagatgctcttgtagaactttcatcacaagaatccagagtccatgtttttt |
25209629 |
T |
 |
| Q |
119 |
aaaagattatattacatattatata--attatatcacatgtgaccttgttactttgttattagtttattttcattgttatctaggtaataactggccagg |
216 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25209630 |
aaaagattatattacatattatatataatcatatcacatgtgaccttgttactttgttattagtttattttcattgttatctaggtaataactggccagg |
25209729 |
T |
 |
| Q |
217 |
tacggcatataaatttaaaatacaataacaaaagtagcaagnnnnnnnnnnttgtaattccttatgaagcatagtattat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25209730 |
tacggcatataaatttaaaatacaataacaaaagtagcaag-aaaaaaaaattgtaattccttatgaagcatagtattat |
25209808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University