View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_low_23 (Length: 251)
Name: NF5880_low_23
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_low_23 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 21064 - 20823
Alignment:
| Q |
1 |
caagttatttttggaacgtattctgaagtggttgtcaacattgtgtcttccataagaactacatttgtttcctttaacctcttttagataaatattattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
21064 |
caagttatttttggaacgtattctgaagtggttgtcaacattgtgtcttccataagaactacatttgtttccttcaacctcttttagataa-tattattt |
20966 |
T |
|
| Q |
101 |
ttcttatcctgcaacggaattgaagaacttctcttgttcatatctaccatgaagtcaaaaagtgtgctgatttactctttaataagggccggtctactac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20965 |
ttcttatcctgcaacggaattgaagaacttctcttgttcatatctaccatgaagtcaaaaagtgtgctgatttactctttaataagggccggtctactac |
20866 |
T |
|
| Q |
201 |
tactttctcttaagttatatttgggttatgttttccctttgct |
243 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20865 |
tactttctcttaagttatatttgggctatgttttccctttgct |
20823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University