View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5880_low_29 (Length: 232)
Name: NF5880_low_29
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5880_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 205
Target Start/End: Complemental strand, 31948834 - 31948779
Alignment:
| Q |
150 |
aacttacagagcacatgtcatactccatgtgaaaggttcttaagttaatcaaatcc |
205 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
31948834 |
aactcacatagcacatgtcatactccatgtggaagattctcaagttaatcaaatcc |
31948779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 198
Target Start/End: Original strand, 27511071 - 27511113
Alignment:
| Q |
156 |
cagagcacatgtcatactccatgtgaaaggttcttaagttaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
27511071 |
cagagcacatgtcatactccatgtgaaacgttctcaaattaat |
27511113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University