View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5881-Insertion-11 (Length: 180)
Name: NF5881-Insertion-11
Description: NF5881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5881-Insertion-11 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 79 - 180
Target Start/End: Original strand, 35034964 - 35035065
Alignment:
| Q |
79 |
tacaactcaagttggacataatatcaatgagtcagttccgcttcctgtatttccgatatcaccatcattaccaccatttcacattgtaccatatggtggg |
178 |
Q |
| |
|
||||| ||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034964 |
tacaaatcaagttggacctaatatcaatagggcagttccgcttcctgtatttccgatatcaccatcattaccaccatttcacattgtaccatatggtggg |
35035063 |
T |
|
| Q |
179 |
ga |
180 |
Q |
| |
|
|| |
|
|
| T |
35035064 |
ga |
35035065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 9 - 71
Target Start/End: Original strand, 35034981 - 35035043
Alignment:
| Q |
9 |
ctaatatcaatagggcagttccgcttcctgtatttccgatatcaccatcattaccaccatttc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034981 |
ctaatatcaatagggcagttccgcttcctgtatttccgatatcaccatcattaccaccatttc |
35035043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University