View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5881-Insertion-12 (Length: 128)
Name: NF5881-Insertion-12
Description: NF5881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5881-Insertion-12 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 3e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 9 - 128
Target Start/End: Original strand, 39030041 - 39030170
Alignment:
| Q |
9 |
tatggcaccttctttggatgcaagacaggacattggggttgagg-agtac--aag-tcggaaa-----gagcagaaaaagctatcaatgaat-gggtcaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| ||| ||||||| |||| ||| ||||||||||||| ||||||| |
|
|
| T |
39030041 |
tatggcaccttctttggatgcaagacaggacattgtggttgaggaagtaccaaagctcggaaaagaagcagcaataaaggctatcaatgaatggggtcaa |
39030140 |
T |
|
| Q |
99 |
cctaagtcaaagattactcatctcatattt |
128 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |
|
|
| T |
39030141 |
cctaagtcaatggttactcatctcatattt |
39030170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 37863463 - 37863420
Alignment:
| Q |
79 |
gctatcaatgaatggg-tcaacctaagtcaaagattactcatct |
121 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37863463 |
gctatcaaggaatggggtcaacctaagtcaaagattactcatct |
37863420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University