View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5881-Insertion-6 (Length: 339)
Name: NF5881-Insertion-6
Description: NF5881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5881-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 9 - 339
Target Start/End: Original strand, 21404256 - 21404586
Alignment:
| Q |
9 |
actattgcaaccaccatatatctgtctagctatatatacaaagtaaaattggttttctcaaagtaaaattggttatggaattaactattggaaacaatgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21404256 |
actattgcaaccaccatatatctgtctagctatatatacaaagtaaaattggttttctcaaagtaaaattggttatggaattaactattggaaacaatgt |
21404355 |
T |
|
| Q |
109 |
atgtaattatgtagagcatgcaaatatgaattcactagtttcttggacatgatcaaattaatcatacccttgagttgtttctttggttcagctgaggcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21404356 |
atgtaattatgtagagcatgcaaatatgaattcactagtttcttggacatgatcaaattaatcatacccttgagttgtttctttggttcagctgaggcaa |
21404455 |
T |
|
| Q |
209 |
tagtagttgtaaccttgacacaagatcattaatctgtttctctttcaactttgaatctcttgagtttctttggctagacatgactctcttttcttaattt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21404456 |
tagtagttgtaaccttgacacaagatcattaatctgtttctctttcaactttgaatctcttgagtttctttggctagacatgactctcttttcttaattt |
21404555 |
T |
|
| Q |
309 |
tcttgtgcttacaatatttggcctttgataa |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21404556 |
tcttgtgcttacaatatttggcctttgataa |
21404586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University