View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5881-Insertion-8 (Length: 277)
Name: NF5881-Insertion-8
Description: NF5881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5881-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 277
Target Start/End: Complemental strand, 4598173 - 4597915
Alignment:
| Q |
18 |
tatgtaaatagagcacattaccttggtattggtcttccttattgctgtaaggattctctaagtggtatatgctttttctctctgaaagtattagatattt |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
4598173 |
tatgtaaatagagtacattaccttggtattggtcttcctt-ttgttttaaggattctctaagtggtatatgctttttccctcttaaagtattagatattt |
4598075 |
T |
|
| Q |
118 |
cattttgttttgtttgtattggttgcgagttagtctgtgtaatagtttttctttcacttgaagagtatttgttgtgcttcagtgtcaatgaaccagattg |
217 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4598074 |
cattttgttttgtttgtattgattgtgagttagtctgtgtaatagtttttctttcagtcaaagaatatttgttgtgcttcagtgtcaatgaaccagattg |
4597975 |
T |
|
| Q |
218 |
gaacagtttgtataatgctagatgcaatttagcctctaagaaatctgttaaatagagcca |
277 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |||| || |||||||||||||| |
|
|
| T |
4597974 |
gaacagtttgtataatgctatatacaatttagcctctcagaattcagttaaatagagcca |
4597915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University