View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5881_high_12 (Length: 250)
Name: NF5881_high_12
Description: NF5881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5881_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 37185170 - 37185110
Alignment:
| Q |
1 |
tggacgaggatggaaacccttcccattctgagtcaacaaccaacaataacaaccaggtaaa |
61 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37185170 |
tggacgaggatggcaacccttcccattctgagtcaacaaccaacaataacaaccaggtaaa |
37185110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 179 - 236
Target Start/End: Complemental strand, 37184995 - 37184938
Alignment:
| Q |
179 |
catgaacttgaagatgatttcagtttgtgtggatatggagatttttatgatgattttg |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37184995 |
catgaacttgatgatgatttcagtttgtgtggatatggagatttttataatgattttg |
37184938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 37187041 - 37186987
Alignment:
| Q |
179 |
catgaacttgaa-gatgatttcagtttgtgtggatatggagatttttatgatgat |
232 |
Q |
| |
|
|||||||||| | ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37187041 |
catgaacttggatgataattttagtttgtgtggatatggagatttttatgatgat |
37186987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 109
Target Start/End: Complemental strand, 37185093 - 37185065
Alignment:
| Q |
81 |
aagaaaaagaaacatgaacttggatgatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37185093 |
aagaaaaagaaacatgaacttggatgatg |
37185065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University