View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5882-Insertion-5 (Length: 170)
Name: NF5882-Insertion-5
Description: NF5882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5882-Insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 4093296 - 4093163
Alignment:
| Q |
8 |
agccttgttagatgaaagccaatccttctatgtcataactaactcaatgatgagtcagctcaacagaaatcatgttggctgcatatgtcaatcaacaaaa |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093296 |
agccttgttagatgaaaaccaatccttctatgtcataactaactcaatgatgagtcagctcaacagaaatcatgttggctgcatatgtcaatcaacaaaa |
4093197 |
T |
|
| Q |
108 |
tcattctgtgtttaaactggtagattccacaggt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
4093196 |
tcattctgtgtttaaactggtagattccgcaggt |
4093163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University