View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884-Insertion-5 (Length: 324)
Name: NF5884-Insertion-5
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884-Insertion-5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 129 - 324
Target Start/End: Complemental strand, 31853241 - 31853046
Alignment:
| Q |
129 |
gaggatgaaaatccttatgtttttgaagacagagattttgaaaccaaaatagaaacagatgatggtagagttatggctctaaacatgtttgatcaaaaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853241 |
gaggatgaaaatccttatgtttttgaagacagagattttgaaaccaaaatagatacagatgatggtagagttatggctctaaacatgtttgatcaaaaat |
31853142 |
T |
|
| Q |
229 |
caaagctgctcagaaactttgagaattatggtttgaccattttagaagctaaaggacatgcttttgtttcaccacaccactttgattctgaggtta |
324 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853141 |
caaagctgcttagaaactttgagaattatggtttgaccattttagaagctaaaggacatgcttttgtttcaccacaccactttgattctgaggtta |
31853046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 31853368 - 31853306
Alignment:
| Q |
8 |
agaggataagcgaatatgcatggacaagtgtgaggactatcatcggatgaagcaagagcgaga |
70 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853368 |
agaggataagggaatatgcatggacaagtgtgaggactatcatcggatgaagcaagagcgaga |
31853306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University