View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884-Insertion-6 (Length: 270)
Name: NF5884-Insertion-6
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 57 - 266
Target Start/End: Complemental strand, 25782850 - 25782640
Alignment:
| Q |
57 |
atacttttttccatgatttaaaaatttataaaggaatgacactttttcaaaagaaattcatgtgattgtaatatgtcgagttccattccatcgttctcat |
156 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||| |
|
|
| T |
25782850 |
atacttttttccattatttaaaaatttataaaggaatgacactttttcaaaagaaattcatgtgattgcaatatgtcgagttccattccatcattttcat |
25782751 |
T |
|
| Q |
157 |
c-annnnnnnatgtaaattggatatcttcgtgcatacaattgattccttgagtctttttggatctaaatggacagcaaactcttccttaaacttaattcg |
255 |
Q |
| |
|
| ||||||||||||||| ||||||||| ||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25782750 |
cgttttttttatgtaaattggatattttcgtgcatgcaagtgattccttaagtcttttaggatctaaatggacagcaaactcttccttaaacttaatttg |
25782651 |
T |
|
| Q |
256 |
ttgcaacgtat |
266 |
Q |
| |
|
||||||||||| |
|
|
| T |
25782650 |
ttgcaacgtat |
25782640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University