View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884-Insertion-8 (Length: 217)
Name: NF5884-Insertion-8
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884-Insertion-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 217
Target Start/End: Complemental strand, 47828635 - 47828423
Alignment:
| Q |
21 |
aaatacttacaatattggtttccacagaagatgtatccactctcagtcctttgatttcattcaatccatct----------------gaaattttttaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47828635 |
aaatacttacaatattggtttccacagaagatgtatccaccctcagtcctttgatttcattcaatccatctaaaggacaagttagaggaaattttttaaa |
47828536 |
T |
|
| Q |
105 |
gggtgtgcttaaattgtacttcttcaaacaggctagctaggattgcttgtgaaccaattaacatctacgtgatattgaagggtgtccggtgtccaacatg |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47828535 |
gggtgcgcttaaattgtacttcttcaaacaggctagctaggattgcttgtgaaccaattaacatctacgtgatattgaagggtgtccggtgtccaacatg |
47828436 |
T |
|
| Q |
205 |
tgtcagtgtccga |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47828435 |
tgtcagtgtccga |
47828423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 59 - 96
Target Start/End: Original strand, 35628861 - 35628898
Alignment:
| Q |
59 |
actctcagtcctttgatttcattcaatccatctgaaat |
96 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35628861 |
actctgagtcctttaatttcattcaatccatctgaaat |
35628898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University