View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_high_12 (Length: 336)
Name: NF5884_high_12
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 62 - 294
Target Start/End: Complemental strand, 7869342 - 7869112
Alignment:
| Q |
62 |
gacaatactcacttactccttctgttggcgaggccattctttgcaaaaaagtgagttacgatattgtatgaattcacaactaatctcacctataataatt |
161 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7869342 |
gacaatactcactcactccttctgttggcgaggccattctttgcaaaagaatgagttacgatattgcatgaattcacaactgatctcacctataataatt |
7869243 |
T |
|
| Q |
162 |
aagtggacattgaaatgtgtttacgtgatggcgaagaacannnnnnnnncatgcaaaaacgacgacatttaacccatatttgacaattaagaaggggaag |
261 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7869242 |
aagtgggcattgaaatgtgtttacgtgatggcgaagaata--tttttttcatgcgaaaacgacgacatttaacccatatctaacaattaagaaggggaag |
7869145 |
T |
|
| Q |
262 |
ctttcgatctttgtcgagctattcattggattg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7869144 |
ctttcgatctttgtcgagctattcattggattg |
7869112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 292
Target Start/End: Complemental strand, 7869090 - 7869056
Alignment:
| Q |
258 |
gaagctttcgatctttgtcgagctattcattggat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7869090 |
gaagctttcgatctttgtcgagctattcattggat |
7869056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University