View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_high_21 (Length: 239)
Name: NF5884_high_21
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 47067511 - 47067726
Alignment:
| Q |
1 |
tacaggtttacttcagatcttgaatgacagcactcagcagtgattctagccttattaaaactttgaatgatgctgacgaggaccagcaagagactggcgg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47067511 |
tacaggtttacttcagatcttggatgacagc-------agtgattctagccttattaaaattttgaatgatgctgacgaggaccagcaagagactggcgg |
47067603 |
T |
 |
| Q |
101 |
aaaccagactatttatcgtgcaacccttgattttgatggggtttttcggctgcatgctcatcatgttaacaatggcagtgacaaaattatcacaagtttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47067604 |
aaaccagactatttatcgtgcaacccttgattttgatggggtttttcggctgcatgctcgtcatgttaacaatggcagtgacaaaattatcgcaagtttt |
47067703 |
T |
 |
| Q |
201 |
ccggggaataacccctgtgaagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47067704 |
ccggggaataacccctgtgaagt |
47067726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 47076725 - 47076649
Alignment:
| Q |
99 |
ggaaaccagactatttatcgtgcaacccttgattttgatggggtttttcggctgcatgctcatcatgttaacaatgg |
175 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
47076725 |
ggaaaccagactatttatcgtgcaactcttgattttgatggggtttttaggctgtatgcttatcatgttaacaatgg |
47076649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University