View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5884_high_22 (Length: 230)

Name: NF5884_high_22
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5884_high_22
NF5884_high_22
[»] chr5 (2 HSPs)
chr5 (140-228)||(42335669-42335756)
chr5 (93-124)||(42335625-42335656)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 140 - 228
Target Start/End: Original strand, 42335669 - 42335756
Alignment:
140 ttctattgcagacctaaggtataggtttcttacttttctttaactcgagagttaaacaaaccaagttcatcatcaatggtggcgcgtgg 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||    
42335669 ttctattgcagacctaaggtataggtttcttacttttctttaactcgagagtt-aacaaaccaagtccatcatcaatggtggcgcgtgg 42335756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 124
Target Start/End: Original strand, 42335625 - 42335656
Alignment:
93 ttatctttaccattaactcttgatttgatggt 124  Q
    ||||||||||||||||||||||||||||||||    
42335625 ttatctttaccattaactcttgatttgatggt 42335656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University