View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_low_11 (Length: 340)
Name: NF5884_low_11
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 7869067 - 7868979
Alignment:
| Q |
1 |
tattcattggatcagtaggttctattttgacaacataatctttgagttggctacggtgtttgatatttgatagttttcatctgaataaaaaagaca |
96 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
7869067 |
tattcattggatcggtaggttctattttaacaacataatctttgagttggctacggcg-------tttgatagttttcatctaaataaaaaagaca |
7868979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 271 - 322
Target Start/End: Complemental strand, 7868558 - 7868507
Alignment:
| Q |
271 |
cacacatcttgcttgtcactctcatcaatgatatctacttccaccgtcctat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7868558 |
cacacatcttgcttgtcactctcatcaatgatatctacttccaccgtcctat |
7868507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 166 - 276
Target Start/End: Complemental strand, 7868907 - 7868805
Alignment:
| Q |
166 |
gagttcattaggacacaatctaata--gtagttcatgagcgagttcaagcagctacatgtatgattggtgctaacccgggttatattgaacaagctattg |
263 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7868907 |
gagttcattaggacacaatctaatatagtaggtcatgaacgagttcaagcag----------gatcggtgctaacccgggttatattgaacaagctattg |
7868818 |
T |
|
| Q |
264 |
ctaatgacacaca |
276 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
7868817 |
ctaatgagacaca |
7868805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University