View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5884_low_12 (Length: 336)

Name: NF5884_low_12
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5884_low_12
NF5884_low_12
[»] chr5 (2 HSPs)
chr5 (62-294)||(7869112-7869342)
chr5 (258-292)||(7869056-7869090)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 62 - 294
Target Start/End: Complemental strand, 7869342 - 7869112
Alignment:
62 gacaatactcacttactccttctgttggcgaggccattctttgcaaaaaagtgagttacgatattgtatgaattcacaactaatctcacctataataatt 161  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||| ||||||||||||||||||    
7869342 gacaatactcactcactccttctgttggcgaggccattctttgcaaaagaatgagttacgatattgcatgaattcacaactgatctcacctataataatt 7869243  T
162 aagtggacattgaaatgtgtttacgtgatggcgaagaacannnnnnnnncatgcaaaaacgacgacatttaacccatatttgacaattaagaaggggaag 261  Q
    |||||| ||||||||||||||||||||||||||||||| |         ||||| |||||||||||||||||||||||| | ||||||||||||||||||    
7869242 aagtgggcattgaaatgtgtttacgtgatggcgaagaata--tttttttcatgcgaaaacgacgacatttaacccatatctaacaattaagaaggggaag 7869145  T
262 ctttcgatctttgtcgagctattcattggattg 294  Q
    |||||||||||||||||||||||||||||||||    
7869144 ctttcgatctttgtcgagctattcattggattg 7869112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 292
Target Start/End: Complemental strand, 7869090 - 7869056
Alignment:
258 gaagctttcgatctttgtcgagctattcattggat 292  Q
    |||||||||||||||||||||||||||||||||||    
7869090 gaagctttcgatctttgtcgagctattcattggat 7869056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University