View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_low_19 (Length: 246)
Name: NF5884_low_19
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 52712704 - 52712482
Alignment:
| Q |
11 |
caaagggaacgatagcttggggaagagcagcctgcaaaagtaattaaacatgattatgttgataaactactaattagaataaagtcattaattgaatttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712704 |
caaagggaacgatagcttggggaagagcagcctgcaaaagtaattaaacatgattgtgttgataaactactaattagaataaagtcattaattgaatttg |
52712605 |
T |
 |
| Q |
111 |
atttgacctgaacaattgcaacatgtaagagaactccacggagaccaactgctaacgaggttgccgcaatcacagctggaccgaccaagaaccttacagc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712604 |
atttgacctgaacaattgcaacatgtaagagaactccacggagaccaactgctaacgaggttgccgcaatcacagctggaccgaccaagaaccttacagc |
52712505 |
T |
 |
| Q |
211 |
catagaatatgttgcaatttttt |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52712504 |
catagaatatgttgcaatttttt |
52712482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 116 - 227
Target Start/End: Complemental strand, 52718253 - 52718142
Alignment:
| Q |
116 |
acctgaacaattgcaacatgtaagagaactccacggagaccaactgctaacgaggttgccgcaatcacagctggaccgaccaagaaccttacagccatag |
215 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52718253 |
acctgaacaattgcaacatgtaacagaactccacggataccaattgctattgaggttgccgcaatcacagctggaccggtcaagaaccttacagccatag |
52718154 |
T |
 |
| Q |
216 |
aatatgttgcaa |
227 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
52718153 |
aaaatgttgcaa |
52718142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University