View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_low_2 (Length: 508)
Name: NF5884_low_2
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 1e-57; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 16 - 153
Target Start/End: Original strand, 7879421 - 7879558
Alignment:
| Q |
16 |
atcgactgtgattgaaccagaaatcataagaaaactaaagcacagaaggaattgtctggaaacaaaacctttatcttgcaatctcgtcatgatccagcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7879421 |
atcgactgtgattgaaccagaaatcacaagaaaactaaagcacggaaggaattgtttggaatcaaaacctttatcttgcaatctcgtcatgatccagcag |
7879520 |
T |
 |
| Q |
116 |
caattaactctcttcatgcgctcttcggttgatcgatt |
153 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7879521 |
cgattaactctcttcatgcgctcttcggttgatggatt |
7879558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 16 - 129
Target Start/End: Complemental strand, 8588768 - 8588655
Alignment:
| Q |
16 |
atcgactgtgattgaaccagaaatcataagaaaactaaagcacagaaggaattgtctggaaacaaaacctttatcttgcaatctcgtcatgatccagcag |
115 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
8588768 |
atcgactgtgatttaaccagaaaccgcaagaaaactaaagcacagaagaaattgtttggaaacaaaacctttatcttgcaatttcgtcatgatccagtaa |
8588669 |
T |
 |
| Q |
116 |
caattaactctctt |
129 |
Q |
| |
|
| |||| ||||||| |
|
|
| T |
8588668 |
cgattacctctctt |
8588655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 294 - 398
Target Start/End: Original strand, 7880221 - 7880331
Alignment:
| Q |
294 |
ctttctaatttcattactttgcatgacattggaaggtggagcc------taaggttatattttcacatatgctacttttgcatatggactatatattata |
387 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| | ||| |||||||| ||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
7880221 |
ctttctaatttcattactttgcatggcattggaaggtggagccttttattgaggctatatttttacagatgctacttttgcatatggactatatagtata |
7880320 |
T |
 |
| Q |
388 |
ttatgaagata |
398 |
Q |
| |
|
|||||||||| |
|
|
| T |
7880321 |
atatgaagata |
7880331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 214 - 274
Target Start/End: Original strand, 7880084 - 7880144
Alignment:
| Q |
214 |
gttgcctcttggttctatttctgtgtgcatgagtatctttatgcatgatcatgagcaatat |
274 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7880084 |
gttgcctcttggttctgtttctgtgtgcatgagtctctttatgcatgatcatgagcaatat |
7880144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 428 - 486
Target Start/End: Original strand, 7881188 - 7881246
Alignment:
| Q |
428 |
ctacatcccaagatgtggtcgaggccaaccttaaaattcagttatcttcccttgaacta |
486 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7881188 |
ctacttcccaagatgtggtcgaggccaaccttaaaattcagttatcttcccctgaacta |
7881246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University