View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_low_22 (Length: 230)
Name: NF5884_low_22
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 140 - 228
Target Start/End: Original strand, 42335669 - 42335756
Alignment:
| Q |
140 |
ttctattgcagacctaaggtataggtttcttacttttctttaactcgagagttaaacaaaccaagttcatcatcaatggtggcgcgtgg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42335669 |
ttctattgcagacctaaggtataggtttcttacttttctttaactcgagagtt-aacaaaccaagtccatcatcaatggtggcgcgtgg |
42335756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 124
Target Start/End: Original strand, 42335625 - 42335656
Alignment:
| Q |
93 |
ttatctttaccattaactcttgatttgatggt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42335625 |
ttatctttaccattaactcttgatttgatggt |
42335656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University