View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5884_low_7 (Length: 375)
Name: NF5884_low_7
Description: NF5884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5884_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 44728221 - 44727976
Alignment:
| Q |
1 |
aaaccactatcatgtccaaaaaccggtgattgaaaatgacgagaaaagattctcggcagtgagatcttaaccatccattgtgtttaccatatgcaggcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44728221 |
aaaccactatcatgtccaaaaaccggtgattgaaaatgacgagaaaagattctcggcagtgagatcttaaccatccattgtgtttaccatatgcaggcaa |
44728122 |
T |
 |
| Q |
101 |
agtcaaatgaaaggaatctaaatggtccttaattacaacggacactctccaatgagattatcacggaagagaatcctaatccgaaaatggcagggagacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44728121 |
agtcaaatgaaaggaatctaaatggtccttaattacaacggacactctccaatgagattatcacggaagagaatcctaatccgaaaatggcagggagacc |
44728022 |
T |
 |
| Q |
201 |
atccgacccaggtactgcagggctcttcatttgggatacagcaatg |
246 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44728021 |
atccgacccaggtactgcctggctcttcatttgggatacagcaatg |
44727976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 245 - 367
Target Start/End: Complemental strand, 44727746 - 44727625
Alignment:
| Q |
245 |
tgaagagttatatatatagattcataaagatggttttctttttattgttgatttttaattttaaagaacatatagtgtaatcatttagcacgaggaaaac |
344 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727746 |
tgaagagttatatatataaattcataaagatggttttctttt-attgttgatttttaattttaaagaacatatagtgtaatcatttagcacgaggaaaac |
44727648 |
T |
 |
| Q |
345 |
gttttggatatctagcctatgct |
367 |
Q |
| |
|
|||||||||||| || ||||||| |
|
|
| T |
44727647 |
gttttggatatccaggctatgct |
44727625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University