View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5885-Insertion-17 (Length: 106)
Name: NF5885-Insertion-17
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5885-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 9 - 106
Target Start/End: Original strand, 19524095 - 19524192
Alignment:
| Q |
9 |
gttaaccattgatatcccttgagtatcagaatggtgtaagagcaaagaatcagacaatgatgtttccatcgcctttgcaccttgcagtgttggttttt |
106 |
Q |
| |
|
|||||||| |||||||||||| || ||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19524095 |
gttaaccaatgatatcccttgtgtgtcataatggtgtaagagcaaaggatcaggcaatgatgtttccatcgcctttgcaccttgcagtgttggttttt |
19524192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 1e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 9 - 106
Target Start/End: Original strand, 41286667 - 41286764
Alignment:
| Q |
9 |
gttaaccattgatatcccttgagtatcagaatggtgtaagagcaaagaatcagacaatgatgtttccatcgcctttgcaccttgcagtgttggttttt |
106 |
Q |
| |
|
|||||||| |||||||||| | || |||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41286667 |
gttaaccagtgatatccctggtgtgtcagaatggtgtaagagcaaaggatcgggcaatgatgtttccatcgcctttgcaccttgcaatgttggttttt |
41286764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University