View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5885_high_32 (Length: 207)
Name: NF5885_high_32
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5885_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 48999490 - 48999666
Alignment:
| Q |
19 |
ctgagaatgaagatcttctgaatcaagcattccaacgagaggagaaatagccccgagcattgcgagtgagcctctcgcttcggaatcttctttcgtcagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48999490 |
ctgagaatgaagatcttctgaatcaagcattccaacgagaggagaaatagccccgagcattgcgagtgagcctctcgcttcggaatcttctttcgtcagt |
48999589 |
T |
|
| Q |
119 |
gatcttactctcgccgccgctattcgccgcttcgtcgagtcttcttcacgtaaatccttaaccacatgcttcatctc |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
48999590 |
gatcttactctcgctgccgctattcgccgctttgtcgagtcttctccgcgtaaatccttaaccacatgcttcatctc |
48999666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University