View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5885_low_25 (Length: 270)

Name: NF5885_low_25
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5885_low_25
NF5885_low_25
[»] chr4 (1 HSPs)
chr4 (1-251)||(47199788-47200039)


Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 47200039 - 47199788
Alignment:
1 taaatcgttgaggtcacattcaaatgggtttggacaaaagtttatgggtttttgcttaggaccgcccgtggagattctcttgggtccctttgagggtatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
47200039 taaatcgttgaggtcacattcaaatgggtttggacaaaagtttatgggtttttgcttaggtccgcccgtggagattctcttgggtccctttgagggtatt 47199940  T
101 tatgtcatttcgttaacaattatgaattcatgatatgatatcagcaagcagtattactctgtttctgtgcgcctgacactggcaggggattccatgttct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47199939 tatgtcatttcgttaacaattatgaattcatgatatgatatcagcaagcagtattactctgtttctgtgcgcctgacactggcaggggattccatgttct 47199840  T
201 a-gggctaggccgttggtttcttttttcttccaaaataaatgaaatactgta 251  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||    
47199839 aggggctaggccgttggtttcttttttcttccaaaataaatgaaatactgta 47199788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University