View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5885_low_25 (Length: 270)
Name: NF5885_low_25
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5885_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 47200039 - 47199788
Alignment:
| Q |
1 |
taaatcgttgaggtcacattcaaatgggtttggacaaaagtttatgggtttttgcttaggaccgcccgtggagattctcttgggtccctttgagggtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47200039 |
taaatcgttgaggtcacattcaaatgggtttggacaaaagtttatgggtttttgcttaggtccgcccgtggagattctcttgggtccctttgagggtatt |
47199940 |
T |
|
| Q |
101 |
tatgtcatttcgttaacaattatgaattcatgatatgatatcagcaagcagtattactctgtttctgtgcgcctgacactggcaggggattccatgttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47199939 |
tatgtcatttcgttaacaattatgaattcatgatatgatatcagcaagcagtattactctgtttctgtgcgcctgacactggcaggggattccatgttct |
47199840 |
T |
|
| Q |
201 |
a-gggctaggccgttggtttcttttttcttccaaaataaatgaaatactgta |
251 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47199839 |
aggggctaggccgttggtttcttttttcttccaaaataaatgaaatactgta |
47199788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University