View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5885_low_26 (Length: 259)
Name: NF5885_low_26
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5885_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 34 - 259
Target Start/End: Complemental strand, 4179456 - 4179231
Alignment:
| Q |
34 |
attgggttgtgagatgtgaagggagggaactgtggctgtgattgtaagccatttttgtgttccaaatatctattgttacatttgttttctgatgcattgc |
133 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4179456 |
attgggttgtgagatgcgaagggagggaactgtggctgtgattgtaagccatttttgtgttccaaatatctattgttacatttgttttttgatgcattgc |
4179357 |
T |
 |
| Q |
134 |
aatttttgatcccatgctattatttacatagtaatgtaggacaggaaccatagtatccctcttttgatgattaggaatcgaacttggtactctgaggatt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4179356 |
aatttttgatcccatgctattatttacatagtaatgtaggacaggaaccatagtatccctcttttgatgattaggaatcgaacttggtactctgaggatt |
4179257 |
T |
 |
| Q |
234 |
actgcactcacaccaccacttacgct |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4179256 |
actgcactcacaccaccacttacgct |
4179231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University